Manipulace se sekvenčními daty

2.1 Konverze formátů sekvencí
Samostatně vyzkoušejte převod formátů sekvencí pomocí nástrojů z programového balíku SMS2 v sekci Format Conversion. Zaměřte se zejména na následující nástroje, které mohou být užitečné:
2.1.1 Vyzkoušejte nástroj EMBL to FASTA
2.1.2 Vyzkoušejte nástroj GenBank to FASTA
2.1.3 Vyzkoušejte nástroj Filter DNA
2.1.4 Vyzkoušejte nástroj Filter Protein
2.1.5 Vyzkoušejte nástroj Reverse Complement a převeďte sekvenci "Sample1" na reverzní komplementární:
>Sample1
ATGGATCKYCC

Jak vypadá reverzní komplemetární sekvence? Odpověď: GGRMGATCCAT
2.2 Translace nukleotidové sekvence
Přeložte nulkeotidovou sekvenci "Sample2" prostřednictvím nástroje Transeq ve všech šesti čtecích rámcích a určete otevřený čtecí rámec, který kóduje nejdelší nepřerušenou proteinovou sekvenci:
>Sample2
CTGTCGCAGCAGATACAACTTGCTTCGGTGATACGTCCATGTAGTCCATTTTTTCTT TAGCCATTGTTGTGTTGTTACCACGGAAGCGACACACAATTTCATCATCAATAAAGC GACCGTTTTCATCAAGACGTGAGTTCGCTTGTGCGACAACGTAACTGTCTTCTTCAT CAGCAGTTAAGTAGTCGATTTGGTCAGTGATCGTGTTTGTTTCGATATCGACTTTAC GATATGGTGTTTCGATAAAGCCAAATTCGTTCACACGTGCATAACTTGATAATGAGT TGATTAAACCAATGTTTGGACCCTCAGGTGTTTCGATTGGACACATACGACCATAGT GAGAGTAGTGGACGTCACGTACTTCCATTCAGCATT

2.2.1 Který ze čtecích rámců je otevřený? Odpověď: -2
2.3 Získání sekvence z databáze
Otevřete sekvenci bakteriofága HK97 v databázi GenBank a v databázi EMBL-Bank. V obou databázích proveďte uložení kompletní sekvence, sekvence kódující Portálový protein Gp3 a reverzní komplementární sekvence regionu 13799..13810.
2.3.1 Uložte kompletní sekvence ve formátu FASTA.
2.3.2 Uložte kompletní sekvence ve formátu GenBank resp. EMBL.
2.3.3 Uložte sekvenci kódující Portálový protein Gp3 ve formátu FASTA.
2.3.4 Uložte sekvenci kódující Portálový protein Gp3 ve formátu GenBank resp. EMBL.
2.3.5 Uložte reverzní komplementární sekvenci regionu 13799..13810. Jak tato sekvence vypadá? Odpověď: CGTAGGTGGTTT
2.4 Sestavení krátkého kontigu ze 4 sekvencí
Nainstalujte si program Chromas 2.6.6 (zdarma). Prostřednictvím programu Chromas otevřete 3 elektroforetogramy. Jednotlivé sekvence z elektroforetogramu vyexportujte ve formátu FASTA a uložte:
CCM4904_16S-1148U.ab1
CCM4904_16S-271U.ab1
CCM4904_16S-553L.ab1

Pomocí nástroje bl2seq (BLAST pro 2 sekvence) nalezněte překryvy mezi těmito sekvencemi a znázorněte je graficky včetně orientace řetězců.
2.4.1 Připravte schematické znázornění překryvů mezi jednotlivými sekvencemi. Odpověď:
překryv sekvencí

2.4.2 Převeďte sekvence tak, aby měly všechny stejnou orientaci. Můžete použít nástroj Reverse Complement, nebo sekvenci převést přímo v Chromas a následně znovu vyexportovat ve formátu FASTA. Nukleotidové sekvence se stejnou orientací znovu přiložte prostřednictvím bl2seq a proveďte jejich manuální spojení do souvislé sekvence v textovém editoru. Jaká je délka sekvence spojené do kontigu (určete např. nástrojem DNA Stats v SMS2)? Odpověď: 1506 nukleotidů
2.4.3 Zkontrolujte správnost sestavené sekvence jejím porovnáním se sekvencí získanou pomocí programu pro automatické sestavení kontigů CAP3.
2.5 Analýza restrikčních míst
Prostřednictvím nástroje NEB Cutter v2.0 proveďte restrikční analýzu sekvence DNA uložené v GenBank pod přístupovým kódem AJ132803. Pro restrikční analýzu použijte sadu všech komerčně dostupných enzymů.
2.5.1 Ve které pozici štěpí sekvenci enzym NdeI? Odpověď: 1779/1781
2.5.2 Kolik enzymů štěpí sekvenci právě 2×? Odpověď: 27
2.5.3 Které enzymy vytvářející 5′-přečnívající konce AATT štěpí sekvenci právě 2×? Odpověď: 3 enzymy : ApoI, EcoRI, MfeI

MENDELOVO CENTRUM pro vzdělávání v biologii, biomedicíně a bioinformatice CZ.1.07/2.3.00/09.0186

Aktuální cvičení:


Další informace:
Cvičení
Nukl. kyseliny
Proteiny
Struktury
Nástroje
Ke stažení
Bioinformatika - proteiny
Bioinformatika - nukl. kyseliny
Bioinformatické databáze
Manipulace se sekvenčními daty
Párové sekvenční přiložení
Mnohonásobné sekvenční přiložení
Návrh primerů
Hledání a identifikace genů
Analýza proteinových sekvencí
NGS data a lokální anotace
Strukturní databáze
Předpověď struktury proteinů
GenBank
EMBL-Bank
DDBJ
dbEST
UniGene
UniProtKB
NRDB
PIR
PROSITE
Pfam
INTERPRO
PDB
MMDB
PDBsum
CATH
SCOP
BLAST
FASTA
LALIGN
ClustalW
T-Coffee
MUSCLE
PSIPRED
JPRED
PHD
PuTTY
WinSCP
SPdbV
PyMOL
RasMol
BioEdit
MEGA3
TreeView